Transcriptional activator of the gltA-gltB operon. Activates expression of the operon in the absence of arginine.
function
positive regulation of the glutamate synthase operon (gltAB)
product
transcriptional regulator (LysR family)
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]Gene
Coordinates
2,014,779 → 2,015,681
Phenotypes of a mutant
''gltC'' mutants are auxotrophic for glutamate, this can be suppressed by the [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]24 mutation or by amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] genomic region [pubmed|9023181,28294562]The protein
Catalyzed reaction/ biological activity
transcription activation of the ''[gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB]'' operon [Pubmed|2548995]Protein family
[SW|LysR family] [Pubmed|2548995]Paralogous protein(s)
none, but there are 19 members of the LysR family in ''B. subtilis[SW|Domains]
DNA-binding helix-turn-helix motif: AA 18 ... 37Effectors of protein activity
2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation [Pubmed|17134717]Expression and Regulation
Operons
genes
[gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
description
[Pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: auto-repression, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]regulation
autoregulation by GltC [Pubmed|2548995]view in new tabBiological materials
Mutant
GP344 (erm), (available in [SW|Jörg Stülke]'s lab)GP738 (gltC::Tn10, spc), (available in [SW|Jörg Stülke]'s lab)GP1904 (''ΔgltC''::''aphA3''), (available in [SW|Jörg Stülke]'s lab) [pubmed|28294562]BKE18460 (Δ[gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGCBKK18460 (Δ[gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGCExpression vector
for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP903, available in [SW|Jörg Stülke]'s labfor expression, purification in ''E. coli'' with C-terminal Strep-tag, in pET3C: pGP951, available in [SW|Jörg Stülke]'s labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s labAntibody
available in [SW|Jörg Stülke]'s labLabs working on this gene/protein
[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage][SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage][SW|Fabian Commichau] University of Göttingen, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]References
Reviews
Original Publications
7559360,15150225,2548995,17183217,17608797,17134717,14523131,20630473,25711804,28294562